Search
  • genegltd

DNA Massaging

What is DNA “massaging”?

DNA “massage”, like a massage treatment, is a tool that helps the amateur bioinformatician handle and process DNA sequences.

There are many DNA sequencing tools and software on the market. Other professional teams employ bioinformatics experts that can do also script coding and handle many more complicated tasks professionally.

What most of us working with common genetics application do in everyday bases:

- Design probes

- BLAST

- Analyze Sanger sequences

- Find SNPs

- Compare different sequences

DNA sequences comes in different formats: FASTA files are most common

https://en.wikipedia.org/wiki/FASTA_format#:~:text=In%20bioinformatics%20and%20biochemistry%2C%20the,comments%20to%20precede%20the%20sequences

The main problem with FASTA format is that it contains line breaks. For BLAST and some primer design SW this does not matter but for some it does. It also makes it challenging to edit these sequences for communicating them in word processors or presentation software.

http://biomodel.uah.es/en/lab/cybertory/analysis/massager.htm

>seq96__15712_B01_4730692.ab1

NNNNNANNNNNTNNNTGAGCTGANANGTGAATTGAATGCTAATGAGGCAGATGATGAAGTTGAAGAAGGTGAAATTGTTG

AAGAAACTGATGATACGACGTCGTATTTGAGCAAAGAAATAGCAACAAAGCATCCATTAGAGCATTCATGGACTTTCTGG

TTTGATAATCCAGTGGAGAAATCGAAACAAGATGCTTGGGGTAGCTCGCTTCGCAACGTCTACACTTTCTCCACTGTTGA

AGATTTTTGGGGGTAAATTTTTTTTAATTTAATTTAATTTTTTATTTTATTGCTTTTTTTTTTGTTTAATAAATTGGGTA

TTAGGGGAATCGAACAATCCCGAACAAGGGGGAAGTTTAGGTAGCCAATTAACTGAGTTATTGCGATTTTTATTTTAGTT

AAGTTTTTTTTAAGGCGTAATATATAAATGGGCACTTTAATATACCCTTGAACTTGTATAAAGTTGAAAAGGTAAACACN

TGTTCCTTATGTGGGGTCCTACAGGTATTATGACCCATTGAACGTTGTGTCTGCTTGTGCACGTCCAAAGTTGGTCATAA

ATGCAAATTGATGCCAAGTTAAAGGGCATGTTTCTGTATTATGCGTTTTTTTTGAGCTAATTATAGGGAAATTGGAAATG

GGGAGGGAATTGCAAGGTGAGGAATCAAACCTTCATGAACNAGGTAAAAGTTGAGGTAGATAATCAATTGAGCTACTAAN

ATTCTCGGGGTATATTTATGGTTGTTGTTTGATTAAAAATGGGGATAGTACCAGGGGAAATGGGNAGGTGTTACAAGGTG

TTGAATNNNNNTTTATNNNTANNGTGAAAGTTAAGTAGTTAATCANTNNGGTATNANATTTTCANTGTTACGTNNNNNNT

TNTGTTGTNNAAANNNGGGANNNGGAAGGNNANNGGNNGNNNNN

>ncbi_example_sequence

1 tgaatctgga gaaggtggca atgagctcat caagagtgtc ctccagtcca tattgagcta

61 tcctggctac tgagaataac ccttcaatgc attcatggag caactcctct tcttcagctt

121 gctcaaaaaa tgcagaaata gctgcgactg atgggccagc aatgcaagca aacatgtctc

181 tccctaaccg gcgatcaaaa tcacatagaa tgaaaggctg cacagttttg gatcggttca

241 tcaactcaat ccatctgctt gggttcatta ttactggcag accggattga ccaaaaaggg

301 tgattgcatt gtttgatatg gac

We recently created an internal offline xls file to do exactly as the online tool does and it also has some advantages over it. We can share this tool with you if you want.

5 views
  • facebook
  • Twitter Clean
  • White Google+ Icon